gene expression

(redirected from Constitutive gene)
Also found in: Dictionary, Medical, Encyclopedia.
Related to Constitutive gene: Gene activation
Graphic Thesaurus  🔍
Display ON
Animation ON
Legend
Synonym
Antonym
Related
  • noun

Words related to gene expression

conversion of the information encoded in a gene first into messenger RNA and then to a protein

Related Words

Based on WordNet 3.0, Farlex clipart collection. © 2003-2012 Princeton University, Farlex Inc.
References in periodicals archive ?
The constitutive genes Actin (F-5'TTGCAGACCGTATGAGCAAG3' and R-5'ATCCTCCGATCCAGACACTG3') and Ubiquitin were used as endogenous references.
Expression of NCED gene in colored cotton genotypes subjected to water stress
In this report, we have suggested that the constitutive gene expression of FUT1 is regulated at 5'-flanking regions at positions -91 to -81 nt of FUT1 and that FUT1 gene expression is upregulated by Elk-1 in DLD-1 cells.
Transcriptional regulation of fucosyltransferase 1 gene expression in colon cancer cells
Constitutive gene products are used to calibrate the response of inducible genes; if these suffer degradation, the adaptive response of the gene of interest will be completely obscured.
Stabilization of mRNA expression in whole blood samples
Molecular genetic manipulation of linseed can be achieved by expressing appropriate transgenes by means of tissue-specific or constitutive gene promoters.
Isolation and Characterization of Two Promoters from Linseed for Genetic Engineering
Thesaurus browser ?
Full browser ?